Transcript: Mouse XM_006522904.3

PREDICTED: Mus musculus avian erythroblastosis virus E-26 (v-ets) oncogene related (Erg), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Erg (13876)
Length:
1999
CDS:
189..1532

Additional Resources:

NCBI RefSeq record:
XM_006522904.3
NBCI Gene record:
Erg (13876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432206 AGCGCTACGCCTACAAGTTTG pLKO_005 1243 CDS 100% 10.800 15.120 N Erg n/a
2 TRCN0000042659 CCGATGACGTTGATAAGGCTT pLKO.1 706 CDS 100% 2.640 3.696 N Erg n/a
3 TRCN0000042662 GTCACTATTTGAGTGTGCCTA pLKO.1 140 5UTR 100% 2.640 3.696 N Erg n/a
4 TRCN0000042658 GCCGACATTCTTCTCTCACAT pLKO.1 645 CDS 100% 4.950 3.960 N Erg n/a
5 TRCN0000417813 ATACTGTACATGGACATATAA pLKO_005 1742 3UTR 100% 15.000 10.500 N Erg n/a
6 TRCN0000435818 ACACCATGTATGATGTCATTT pLKO_005 1931 3UTR 100% 13.200 9.240 N Erg n/a
7 TRCN0000042660 CCCGAAGCTACGCAAAGAATT pLKO.1 804 CDS 100% 0.000 0.000 N Erg n/a
8 TRCN0000042661 CCTGCCATACATGGGCTCCTA pLKO.1 1334 CDS 100% 0.880 0.528 N Erg n/a
9 TRCN0000431367 CGTCCTCAGTTAGATCCTTAT pLKO_005 951 CDS 100% 10.800 15.120 N ERG n/a
10 TRCN0000013915 GCGGTGAAAGAATATGGCCTT pLKO.1 528 CDS 100% 2.160 1.512 N ERG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06179 pDONR223 100% 83.8% 90.3% None (many diffs) n/a
2 TRCN0000465638 GCTAAATAAATTACTAAAGGACGC pLX_317 24.3% 83.8% 90.3% V5 (many diffs) n/a
3 ccsbBroad304_06179 pLX_304 26.4% 75% 64.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV