Transcript: Mouse XM_006523926.3

PREDICTED: Mus musculus special AT-rich sequence binding protein 1 (Satb1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Satb1 (20230)
Length:
6053
CDS:
357..2747

Additional Resources:

NCBI RefSeq record:
XM_006523926.3
NBCI Gene record:
Satb1 (20230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039093 CGTTGCTGTCTCTAGGCTATT pLKO.1 697 CDS 100% 10.800 15.120 N Satb1 n/a
2 TRCN0000413050 GAAGGGAGCACAGACGTTAAT pLKO_005 2709 CDS 100% 13.200 10.560 N Satb1 n/a
3 TRCN0000412817 AGGTGCCAACCACGTCAATTT pLKO_005 1142 CDS 100% 13.200 9.240 N Satb1 n/a
4 TRCN0000430865 TTGTGAACAGCACGTACTATG pLKO_005 1012 CDS 100% 10.800 7.560 N Satb1 n/a
5 TRCN0000039092 CCCTGTCAGTAGGTCTATGAA pLKO.1 1409 CDS 100% 5.625 3.938 N Satb1 n/a
6 TRCN0000039091 CCTGTCGATGATCCGAAGATT pLKO.1 2000 CDS 100% 5.625 3.938 N Satb1 n/a
7 TRCN0000039090 CCCGAAGTACACCATCATCAA pLKO.1 2507 CDS 100% 4.950 3.465 N Satb1 n/a
8 TRCN0000039089 GCTTTCTGAAATCCTCCGAAA pLKO.1 1568 CDS 100% 4.050 2.835 N Satb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01484 pDONR223 100% 87.7% 94.2% None (many diffs) n/a
2 ccsbBroad304_01484 pLX_304 0% 87.7% 94.2% V5 (many diffs) n/a
3 TRCN0000474374 AAACCATCTCCGACATGAATGTTA pLX_317 24.6% 87.7% 94.2% V5 (many diffs) n/a
Download CSV