Transcript: Mouse XM_006524151.3

PREDICTED: Mus musculus phospholipase C-like 2 (Plcl2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plcl2 (224860)
Length:
4542
CDS:
556..3942

Additional Resources:

NCBI RefSeq record:
XM_006524151.3
NBCI Gene record:
Plcl2 (224860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524151.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321737 CGTGCTTGCTGAGCCATATTT pLKO_005 4342 3UTR 100% 15.000 12.000 N Plcl2 n/a
2 TRCN0000026950 CCAGAATTTACCATCGGTATT pLKO.1 1025 CDS 100% 10.800 8.640 N Plcl2 n/a
3 TRCN0000026929 CCCTTATGTCTATGTGGAAAT pLKO.1 2898 CDS 100% 10.800 8.640 N Plcl2 n/a
4 TRCN0000321735 CCCTTATGTCTATGTGGAAAT pLKO_005 2898 CDS 100% 10.800 8.640 N Plcl2 n/a
5 TRCN0000360866 CCCACGTGTGAAGGCAAATAA pLKO_005 4090 3UTR 100% 15.000 10.500 N Plcl2 n/a
6 TRCN0000360865 ATGAAGTACTTGCGAGTAAAT pLKO_005 2504 CDS 100% 13.200 9.240 N Plcl2 n/a
7 TRCN0000321736 GTTCGTCCACGTGGCTATTAC pLKO_005 3180 CDS 100% 13.200 9.240 N Plcl2 n/a
8 TRCN0000026943 CCTCTCATCTTATGTTTAGAA pLKO.1 2098 CDS 100% 5.625 3.938 N Plcl2 n/a
9 TRCN0000321673 CCTCTCATCTTATGTTTAGAA pLKO_005 2098 CDS 100% 5.625 3.938 N Plcl2 n/a
10 TRCN0000026902 CCTGATTGTTACATCTTTGAT pLKO.1 1792 CDS 100% 5.625 3.938 N Plcl2 n/a
11 TRCN0000026884 CCAGTGTATCAGAAACCTCAA pLKO.1 1437 CDS 100% 4.050 2.835 N Plcl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524151.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07858 pDONR223 100% 79.1% 86.3% None (many diffs) n/a
2 ccsbBroad304_07858 pLX_304 0% 79.1% 86.3% V5 (many diffs) n/a
3 TRCN0000478617 ATAATACTTTAATGACCGAAGTTC pLX_317 11.4% 79.1% 86.3% V5 (many diffs) n/a
Download CSV