Transcript: Mouse XM_006524393.3

PREDICTED: Mus musculus kinesin family member 6 (Kif6), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif6 (319991)
Length:
5491
CDS:
134..1981

Additional Resources:

NCBI RefSeq record:
XM_006524393.3
NBCI Gene record:
Kif6 (319991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091834 CCTGGCAGATGGATTCGTAAA pLKO.1 262 CDS 100% 10.800 7.560 N Kif6 n/a
2 TRCN0000091836 CAAGGGATTTACTCCATAGAT pLKO.1 194 CDS 100% 5.625 3.938 N Kif6 n/a
3 TRCN0000091837 CACGACACACATTTCTTACTT pLKO.1 550 CDS 100% 5.625 3.938 N Kif6 n/a
4 TRCN0000091835 GAGGAACATTGATGAGTCTAT pLKO.1 1111 CDS 100% 4.950 3.465 N Kif6 n/a
5 TRCN0000091833 GCATCCTATTTGGAAGACCAA pLKO.1 1331 CDS 100% 2.640 1.848 N Kif6 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4408 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13426 pDONR223 100% 57.4% 60.3% None (many diffs) n/a
2 ccsbBroad304_13426 pLX_304 0% 57.4% 60.3% V5 (many diffs) n/a
3 TRCN0000468540 CAAGGGTATGTCCTGTGCAACCAA pLX_317 17.7% 57.4% 60.3% V5 (many diffs) n/a
Download CSV