Transcript: Mouse XM_006525703.2

PREDICTED: Mus musculus SMAD family member 7 (Smad7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smad7 (17131)
Length:
3166
CDS:
319..1596

Additional Resources:

NCBI RefSeq record:
XM_006525703.2
NBCI Gene record:
Smad7 (17131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305818 CTAACCTTTCCCGAGTGATTG pLKO_005 1670 3UTR 100% 10.800 15.120 N Smad7 n/a
2 TRCN0000096051 GCTGTGAATCTTACGGGAAGA pLKO.1 854 CDS 100% 4.050 5.670 N Smad7 n/a
3 TRCN0000096052 ACAGCTCAATTCGGACAACAA pLKO.1 1212 CDS 100% 4.950 3.960 N Smad7 n/a
4 TRCN0000305816 AGCAACCATGGACGGGTTTCA pLKO_005 1475 CDS 100% 4.950 3.960 N Smad7 n/a
5 TRCN0000305753 AGTCGACTCTGTGAACTAGAG pLKO_005 913 CDS 100% 4.050 3.240 N Smad7 n/a
6 TRCN0000305817 CCTCCCTGGATATCTTCTATG pLKO_005 1160 CDS 100% 10.800 7.560 N Smad7 n/a
7 TRCN0000096053 CTCCAGATACCCAATGGATTT pLKO.1 951 CDS 100% 10.800 7.560 N Smad7 n/a
8 TRCN0000019386 CGTGCAGATCAGCTTTGTGAA pLKO.1 1497 CDS 100% 4.950 3.465 N SMAD7 n/a
9 TRCN0000096050 GCACAAAGTGTTCCCTGGTTT pLKO.1 1386 CDS 100% 4.950 3.465 N Smad7 n/a
10 TRCN0000324376 GCACAAAGTGTTCCCTGGTTT pLKO_005 1386 CDS 100% 4.950 3.465 N Smad7 n/a
11 TRCN0000222190 GCTTTCAGATTCCCAACTTCT pLKO.1 1050 CDS 100% 4.950 3.465 N SMAD7 n/a
12 TRCN0000096049 GCAAACTCTTTGGTTGGTGTT pLKO.1 1699 3UTR 100% 4.050 2.835 N Smad7 n/a
13 TRCN0000222189 CTGTGAATCTTACGGGAAGAT pLKO.1 855 CDS 100% 0.495 0.347 N SMAD7 n/a
14 TRCN0000222188 CGGCCCAATGACCACGAGTTT pLKO.1 1450 CDS 100% 1.650 1.320 N SMAD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00964 pDONR223 100% 95.1% 97.8% None (many diffs) n/a
2 TRCN0000476798 TCAGATTCTGTTACAGAAGTAAAA pLX_317 24.7% 95.1% 97.8% V5 (many diffs) n/a
Download CSV