Transcript: Mouse XM_006525950.2

PREDICTED: Mus musculus Sin3A associated protein (Sap130), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sap130 (269003)
Length:
4202
CDS:
371..3601

Additional Resources:

NCBI RefSeq record:
XM_006525950.2
NBCI Gene record:
Sap130 (269003)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248220 TGACGATCTACATCGAATAAA pLKO_005 3409 CDS 100% 15.000 21.000 N Sap130 n/a
2 TRCN0000248217 ATCTATCCTCTCTAGACTAAA pLKO_005 3958 3UTR 100% 13.200 18.480 N Sap130 n/a
3 TRCN0000173463 GCGACTGATGACGATCTACAT pLKO.1 3401 CDS 100% 4.950 6.930 N Sap130 n/a
4 TRCN0000217226 CCAGTAACCTGCATCACATTA pLKO.1 945 CDS 100% 13.200 9.240 N Sap130 n/a
5 TRCN0000248219 TGCCTCACATGCCCGACATAT pLKO_005 2005 CDS 100% 13.200 9.240 N Sap130 n/a
6 TRCN0000257695 GTGACCACCTCCAGTACAATC pLKO_005 1187 CDS 100% 10.800 7.560 N Sap130 n/a
7 TRCN0000248218 GTGGCCATGGAAACCCGAAAT pLKO_005 1757 CDS 100% 10.800 7.560 N Sap130 n/a
8 TRCN0000174900 GCATTGAATTACAGGACACTT pLKO.1 3698 3UTR 100% 4.950 3.465 N Sap130 n/a
9 TRCN0000175862 GAAAGCTGCTTATCACCACTT pLKO.1 3175 CDS 100% 4.050 2.835 N Sap130 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12570 pDONR223 100% 56% 59.9% None (many diffs) n/a
2 ccsbBroad304_12570 pLX_304 0% 56% 59.9% V5 (many diffs) n/a
3 TRCN0000474581 CGAGACCTTGCACACCGGTTTCAC pLX_317 25.4% 56% 59.9% V5 (many diffs) n/a
Download CSV