Transcript: Mouse XM_006526149.1

PREDICTED: Mus musculus Nedd4 family interacting protein 1 (Ndfip1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ndfip1 (65113)
Length:
1800
CDS:
203..868

Additional Resources:

NCBI RefSeq record:
XM_006526149.1
NBCI Gene record:
Ndfip1 (65113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526149.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265322 CTACAACACTGCCCAGTTATG pLKO_005 411 CDS 100% 10.800 15.120 N Ndfip1 n/a
2 TRCN0000276163 CTATTTGTTCCTAGGTGTAAA pLKO_005 1027 3UTR 100% 13.200 10.560 N NDFIP1 n/a
3 TRCN0000251819 CCTGTTTCTCAGAGGATTTAT pLKO_005 772 CDS 100% 15.000 10.500 N Ndfip1 n/a
4 TRCN0000251818 CCTATTTCCCTGGATACTTTG pLKO_005 705 CDS 100% 10.800 7.560 N Ndfip1 n/a
5 TRCN0000251821 TCTAATTAAGTGGATCCTTAT pLKO_005 670 CDS 100% 10.800 7.560 N Ndfip1 n/a
6 TRCN0000130380 GCCAGAAACTTTCTCAAATCT pLKO.1 817 CDS 100% 5.625 3.938 N NDFIP1 n/a
7 TRCN0000281984 GCCAGAAACTTTCTCAAATCT pLKO_005 817 CDS 100% 5.625 3.938 N NDFIP1 n/a
8 TRCN0000251820 GGCTTCCTGCACTGATGAAGT pLKO_005 902 3UTR 100% 4.950 3.465 N Ndfip1 n/a
9 TRCN0000129400 GTTCGGAAGATGCCAGAAACT pLKO.1 806 CDS 100% 4.950 3.465 N NDFIP1 n/a
10 TRCN0000276161 GTTCGGAAGATGCCAGAAACT pLKO_005 806 CDS 100% 4.950 3.465 N NDFIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526149.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09046 pDONR223 100% 93% 96.8% None (many diffs) n/a
2 ccsbBroad304_09046 pLX_304 0% 93% 96.8% V5 (many diffs) n/a
3 TRCN0000472369 AGCTAGCCCCGTTATGCTTATCCA pLX_317 68.8% 93% 96.8% V5 (many diffs) n/a
Download CSV