Transcript: Mouse XM_006526209.3

PREDICTED: Mus musculus spire homolog 1 (Drosophila) (Spire1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spire1 (68166)
Length:
5690
CDS:
204..2612

Additional Resources:

NCBI RefSeq record:
XM_006526209.3
NBCI Gene record:
Spire1 (68166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216096 CATACTCTACTCTACCTATCT pLKO.1 2236 CDS 100% 4.950 6.930 N Spire1 n/a
2 TRCN0000183158 GCCTTGCTGATAATTCTCTTT pLKO.1 3098 3UTR 100% 4.950 6.930 N Spire1 n/a
3 TRCN0000184690 CCCTTCAGAACGGACTATCAA pLKO.1 2582 CDS 100% 5.625 4.500 N Spire1 n/a
4 TRCN0000217603 GAGGTCATCCTTGACTTTATC pLKO.1 1179 CDS 100% 13.200 9.240 N Spire1 n/a
5 TRCN0000216307 GAGAATCATCTATGGTGAATG pLKO.1 1429 CDS 100% 10.800 7.560 N Spire1 n/a
6 TRCN0000196199 GAGATGCTCATGGACGACATT pLKO.1 1083 CDS 100% 4.950 3.465 N Spire1 n/a
7 TRCN0000183497 GAGAACCTTAAGAAGATTCAA pLKO.1 891 CDS 100% 5.625 3.375 N Spire1 n/a
8 TRCN0000183542 GCTTAGAAATAACTGGGCAAT pLKO.1 3733 3UTR 100% 4.050 2.430 N Spire1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12310 pDONR223 100% 14.2% 15.3% None (many diffs) n/a
2 ccsbBroad304_12310 pLX_304 0% 14.2% 15.3% V5 (many diffs) n/a
3 TRCN0000472607 ACGGTGAGGGCTGTTAGTCCAACG pLX_317 100% 14.2% 15.3% V5 (many diffs) n/a
Download CSV