Transcript: Mouse XM_006526291.3

PREDICTED: Mus musculus IWS1 homolog (S. cerevisiae) (Iws1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Iws1 (73473)
Length:
2928
CDS:
273..2570

Additional Resources:

NCBI RefSeq record:
XM_006526291.3
NBCI Gene record:
Iws1 (73473)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376549 GCTCTCACCTCTACCAGATAG pLKO_005 1970 CDS 100% 10.800 7.560 N IWS1 n/a
2 TRCN0000125596 CCATCAAACAAGGACTATGTT pLKO.1 2382 CDS 100% 5.625 3.938 N Iws1 n/a
3 TRCN0000125598 CGGGAGGAATTGTTAAAGATT pLKO.1 2013 CDS 100% 5.625 3.938 N Iws1 n/a
4 TRCN0000125594 GCCATGATTGTCAAGATGAAT pLKO.1 1797 CDS 100% 5.625 3.938 N Iws1 n/a
5 TRCN0000125595 CGAGCAGTGATGTATCTGTAT pLKO.1 2088 CDS 100% 4.950 3.465 N Iws1 n/a
6 TRCN0000125597 CGCCATGATTGTCAAGATGAA pLKO.1 1796 CDS 100% 4.950 3.465 N Iws1 n/a
7 TRCN0000161110 GCTGTGCTTTCTGATAGTGAA pLKO.1 1290 CDS 100% 4.950 3.465 N IWS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465982 TTTTGGTTGACGGAGATATTCTGT pLX_317 13.3% 80.1% 81.3% V5 (many diffs) n/a
2 ccsbBroadEn_12249 pDONR223 100% 6.1% 1.6% None (many diffs) n/a
3 ccsbBroad304_12249 pLX_304 0% 6.1% 1.6% V5 (many diffs) n/a
4 TRCN0000471391 TAAAAACCGCAAATACATCTTTGC pLX_317 100% 6.1% 1.6% V5 (many diffs) n/a
Download CSV