Transcript: Mouse XM_006526293.2

PREDICTED: Mus musculus proteasome (prosome, macropain) subunit, alpha type, 8 (Psma8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psma8 (73677)
Length:
1591
CDS:
97..729

Additional Resources:

NCBI RefSeq record:
XM_006526293.2
NBCI Gene record:
Psma8 (73677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032253 CCGTCACTGTAGAGTATATAA pLKO.1 404 CDS 100% 15.000 21.000 N Psma8 n/a
2 TRCN0000032252 CGGTTGGAATTCGAGGAACTA pLKO.1 197 CDS 100% 0.000 0.000 N Psma8 n/a
3 TRCN0000032249 GCGACGCTAAAGCAGAAATAT pLKO.1 436 CDS 100% 15.000 10.500 N Psma8 n/a
4 TRCN0000032250 CCAAGATTGTATCAGACAGAT pLKO.1 526 CDS 100% 4.950 3.465 N Psma8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14389 pDONR223 100% 67.9% 73.8% None (many diffs) n/a
2 ccsbBroad304_14389 pLX_304 0% 67.9% 73.8% V5 (many diffs) n/a
3 TRCN0000474962 CCTTGCCCGCTCACACCCGCCATT pLX_317 70.5% 67.9% 73.8% V5 (many diffs) n/a
4 ccsbBroadEn_16098 pDONR223 0% 55.7% 60% None (many diffs) n/a
Download CSV