Transcript: Mouse XM_006526593.3

PREDICTED: Mus musculus fermitin family member 3 (Fermt3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fermt3 (108101)
Length:
2565
CDS:
205..2202

Additional Resources:

NCBI RefSeq record:
XM_006526593.3
NBCI Gene record:
Fermt3 (108101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189670 CGACCTCTATGTAGTCCCTAA pLKO.1 2435 3UTR 100% 4.050 5.670 N Fermt3 n/a
2 TRCN0000420776 GAGTTCGATGAACACATCAAT pLKO_005 2032 CDS 100% 5.625 3.938 N Fermt3 n/a
3 TRCN0000129604 CCTGCAGTACCACATCAACAA pLKO.1 1092 CDS 100% 4.950 3.465 N FERMT3 n/a
4 TRCN0000438252 CCTGCAGTACCACATCAACAA pLKO_005 1092 CDS 100% 4.950 3.465 N Fermt3 n/a
5 TRCN0000192147 GACCTGACAAAGGTTGTCTTA pLKO.1 691 CDS 100% 4.950 3.465 N Fermt3 n/a
6 TRCN0000189980 GCTGGATAGTCTCACTACCAT pLKO.1 1230 CDS 100% 3.000 2.100 N Fermt3 n/a
7 TRCN0000190125 CGTGGAGGAAATCAATCGCAA pLKO.1 351 CDS 100% 2.640 1.848 N Fermt3 n/a
8 TRCN0000189676 GAGGAACCACAAATCCTGGTT pLKO.1 2482 3UTR 100% 0.264 0.185 N Fermt3 n/a
9 TRCN0000414228 CGATTTAAGTACTACAGCTTT pLKO_005 952 CDS 100% 4.950 2.970 N Fermt3 n/a
10 TRCN0000134370 GAAGAAGAAGAAGGAGAAGAA pLKO.1 651 CDS 100% 4.950 2.475 Y TNFAIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09109 pDONR223 100% 86.6% 93.8% None (many diffs) n/a
2 ccsbBroad304_09109 pLX_304 0% 86.6% 93.8% V5 (many diffs) n/a
3 TRCN0000491967 GGTTATATGCATCTGTGTACGGTC pLX_317 17.1% 86.6% 93.8% V5 (many diffs) n/a
Download CSV