Transcript: Mouse XM_006526697.3

PREDICTED: Mus musculus G protein-coupled receptor kinase 5 (Grk5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grk5 (14773)
Length:
6623
CDS:
971..2647

Additional Resources:

NCBI RefSeq record:
XM_006526697.3
NBCI Gene record:
Grk5 (14773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274575 AGTTGTAACCACCGAATAAAT pLKO_005 2588 CDS 100% 15.000 21.000 N Grk5 n/a
2 TRCN0000274517 GGACCATACGGACGATGATTT pLKO_005 2347 CDS 100% 13.200 18.480 N Grk5 n/a
3 TRCN0000022832 GCTGAATGTGTTCGGACCTAA pLKO.1 2443 CDS 100% 4.950 3.960 N Grk5 n/a
4 TRCN0000274518 GCTGAATGTGTTCGGACCTAA pLKO_005 2443 CDS 100% 4.950 3.960 N Grk5 n/a
5 TRCN0000022829 CCTGGACTTAGTGGCAGAATA pLKO.1 1123 CDS 100% 13.200 9.240 N Grk5 n/a
6 TRCN0000285245 CCTGGACTTAGTGGCAGAATA pLKO_005 1123 CDS 100% 13.200 9.240 N Grk5 n/a
7 TRCN0000274519 TCAGACTTTGAGGGTGTATAT pLKO_005 3044 3UTR 100% 13.200 9.240 N Grk5 n/a
8 TRCN0000022833 CCCTGCAAAGAACTCTTCTCT pLKO.1 1283 CDS 100% 3.000 2.100 N Grk5 n/a
9 TRCN0000022831 CTCATCTATGAGATGATTGAA pLKO.1 1994 CDS 100% 0.563 0.394 N Grk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488904 TAAACTCATCTGACCCGGGACTTC pLX_317 14.3% 83.2% 89.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV