Transcript: Mouse XM_006526715.3

PREDICTED: Mus musculus Janus kinase 2 (Jak2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jak2 (16452)
Length:
4622
CDS:
520..2325

Additional Resources:

NCBI RefSeq record:
XM_006526715.3
NBCI Gene record:
Jak2 (16452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023651 CGGCCCAATATCAATGGATTT pLKO.1 1722 CDS 100% 10.800 8.640 N Jak2 n/a
2 TRCN0000278192 CGGCCCAATATCAATGGATTT pLKO_005 1722 CDS 100% 10.800 8.640 N Jak2 n/a
3 TRCN0000023653 CCAACATTACAGAGGCATAAT pLKO.1 2089 CDS 100% 13.200 9.240 N Jak2 n/a
4 TRCN0000278124 CCAACATTACAGAGGCATAAT pLKO_005 2089 CDS 100% 13.200 9.240 N Jak2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_14680 pLX_304 14.6% 46.5% 54.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14680 pDONR223 0% 46.5% 48.1% None (many diffs) n/a
3 TRCN0000472785 CCCCCACGAGTCAAACATTTAGTC pLX_317 12.6% 46.5% 48.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488199 AACGTGGACCCGTCCGTGGCAGGT pLX_317 8.7% 46.4% 48.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_10929 pDONR223 100% 46.3% 47.9% None (many diffs) n/a
6 ccsbBroad304_10929 pLX_304 0% 46.3% 47.9% V5 (many diffs) n/a
Download CSV