Transcript: Mouse XM_006526816.2

PREDICTED: Mus musculus deltex 4, E3 ubiquitin ligase (Dtx4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dtx4 (207521)
Length:
4885
CDS:
206..1738

Additional Resources:

NCBI RefSeq record:
XM_006526816.2
NBCI Gene record:
Dtx4 (207521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040777 CGCCGTCTCATCTTTGCCATT pLKO.1 1535 CDS 100% 4.050 5.670 N Dtx4 n/a
2 TRCN0000040774 GCCCAACATGTAAGACCATTT pLKO.1 1269 CDS 100% 10.800 8.640 N Dtx4 n/a
3 TRCN0000040775 CATTGGCTTCAGCTACATAAT pLKO.1 271 CDS 100% 13.200 9.240 N Dtx4 n/a
4 TRCN0000236609 GGCTACCCAGATGCCAATTAC pLKO_005 1646 CDS 100% 13.200 9.240 N DTX4 n/a
5 TRCN0000040773 GCCACTTTGAATCGGTCCAAT pLKO.1 746 CDS 100% 4.950 3.465 N Dtx4 n/a
6 TRCN0000040776 CCAGATGCCAATTACCTGGAT pLKO.1 1652 CDS 100% 2.640 1.848 N Dtx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11698 pDONR223 100% 86.9% 92.5% None (many diffs) n/a
2 ccsbBroad304_11698 pLX_304 0% 86.9% 92.5% V5 (many diffs) n/a
3 TRCN0000465429 GCTCTGGAGTCGTTACAGTTTAGG pLX_317 22.3% 86.9% 92.5% V5 (many diffs) n/a
Download CSV