Transcript: Mouse XM_006527065.2

PREDICTED: Mus musculus 3'-phosphoadenosine 5'-phosphosulfate synthase 2 (Papss2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Papss2 (23972)
Length:
3636
CDS:
168..2018

Additional Resources:

NCBI RefSeq record:
XM_006527065.2
NBCI Gene record:
Papss2 (23972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024945 GCTCTATTACAGGACCCTGAA pLKO.1 1146 CDS 100% 4.050 5.670 N Papss2 n/a
2 TRCN0000024944 GCGTGGAAAGTGTTGACAGAT pLKO.1 1968 CDS 100% 4.950 3.465 N Papss2 n/a
3 TRCN0000353201 GCGTGGAAAGTGTTGACAGAT pLKO_005 1968 CDS 100% 4.950 3.465 N Papss2 n/a
4 TRCN0000024947 GCTTTGGAAGAGTACCTTGTA pLKO.1 351 CDS 100% 4.950 3.465 N Papss2 n/a
5 TRCN0000280566 GCTTTGGAAGAGTACCTTGTA pLKO_005 351 CDS 100% 4.950 3.465 N Papss2 n/a
6 TRCN0000024946 GCAGGAGAGATTAAAGGGTTT pLKO.1 675 CDS 100% 4.050 2.835 N Papss2 n/a
7 TRCN0000280502 GCAGGAGAGATTAAAGGGTTT pLKO_005 675 CDS 100% 4.050 2.835 N Papss2 n/a
8 TRCN0000024948 CCATCATGTGAGCAGGAACAA pLKO.1 236 CDS 100% 4.950 2.970 N Papss2 n/a
9 TRCN0000280504 CCATCATGTGAGCAGGAACAA pLKO_005 236 CDS 100% 4.950 2.970 N Papss2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2405 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488360 GTGGCAGCCCGATGATTGATGACA pLX_317 17.1% 86.1% 91.8% V5 (many diffs) n/a
2 ccsbBroadEn_02071 pDONR223 100% 86.1% 91.8% None (many diffs) n/a
3 ccsbBroad304_02071 pLX_304 0% 86.1% 91.8% V5 (many diffs) n/a
4 ccsbBroadEn_14924 pDONR223 0% 86.1% 91.8% None (many diffs) n/a
5 ccsbBroad304_14924 pLX_304 0% 86.1% 91.8% V5 (many diffs) n/a
6 TRCN0000466192 TCGATCCAGTTAACCTTACAAGCG pLX_317 17.2% 86.1% 91.8% V5 (many diffs) n/a
7 TRCN0000488533 AGTCTGTTCGCAACAGTATGGATG pLX_317 20.8% 86.1% 91.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV