Transcript: Mouse XM_006527222.3

PREDICTED: Mus musculus adenylate kinase 3 (Ak3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ak3 (56248)
Length:
1087
CDS:
263..1054

Additional Resources:

NCBI RefSeq record:
XM_006527222.3
NBCI Gene record:
Ak3 (56248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527222.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024780 CGTGCCCTTTGAGGTCATTAA pLKO.1 607 CDS 100% 13.200 18.480 N Ak3 n/a
2 TRCN0000353177 CGTGCCCTTTGAGGTCATTAA pLKO_005 607 CDS 100% 13.200 18.480 N Ak3 n/a
3 TRCN0000024779 GCCAAGACTTTCATTGACCAA pLKO.1 428 CDS 100% 2.640 3.696 N Ak3 n/a
4 TRCN0000353176 GCCAAGACTTTCATTGACCAA pLKO_005 428 CDS 100% 2.640 3.696 N Ak3 n/a
5 TRCN0000024783 GTCACGCATCACCAAACACTT pLKO.1 334 CDS 100% 4.950 3.465 N Ak3 n/a
6 TRCN0000024782 CCTGGATAAAGTTTATCAGAT pLKO.1 565 CDS 100% 4.950 2.970 N Ak3 n/a
7 TRCN0000345199 CCTGGATAAAGTTTATCAGAT pLKO_005 565 CDS 100% 4.950 2.970 N Ak3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527222.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03152 pDONR223 100% 71.7% 64.8% None (many diffs) n/a
2 ccsbBroad304_03152 pLX_304 0% 71.7% 64.8% V5 (many diffs) n/a
3 TRCN0000472819 AAATTGAGAGAAGCTGGCCCGTTT pLX_317 68% 71.7% 64.8% V5 (many diffs) n/a
4 ccsbBroadEn_15057 pDONR223 0% 71.7% 64.8% None (many diffs) n/a
5 ccsbBroad304_15057 pLX_304 0% 71.7% 64.8% V5 (many diffs) n/a
6 TRCN0000469861 GCCGCTTCATGTGAACTCCGGGCT pLX_317 60.7% 71.7% 64.8% V5 (many diffs) n/a
7 TRCN0000492274 AGCTCCAGGAGATTATGGCGGCAC pLX_317 65.7% 71.7% 64.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV