Transcript: Mouse XM_006527431.3

PREDICTED: Mus musculus polycomb group ring finger 5 (Pcgf5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcgf5 (76073)
Length:
6436
CDS:
370..1140

Additional Resources:

NCBI RefSeq record:
XM_006527431.3
NBCI Gene record:
Pcgf5 (76073)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095162 GCTGTGCAATGGTGAAATTAT pLKO.1 951 CDS 100% 15.000 21.000 N Pcgf5 n/a
2 TRCN0000095160 CGAGTTACTGTAGGAACTATT pLKO.1 877 CDS 100% 13.200 18.480 N Pcgf5 n/a
3 TRCN0000095163 CACGAGTTACTGTAGGAACTA pLKO.1 875 CDS 100% 4.950 6.930 N Pcgf5 n/a
4 TRCN0000095159 GCTGAATGAATCCTGCACTAT pLKO.1 1157 3UTR 100% 4.950 6.930 N Pcgf5 n/a
5 TRCN0000295879 TGCTGTGCAATGGTGAAATTA pLKO_005 950 CDS 100% 15.000 10.500 N PCGF5 n/a
6 TRCN0000095161 GCAATGGTGAAATTATGGGAA pLKO.1 956 CDS 100% 2.640 1.848 N Pcgf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04383 pDONR223 100% 90.3% 96% None (many diffs) n/a
2 ccsbBroad304_04383 pLX_304 0% 90.3% 96% V5 (many diffs) n/a
3 TRCN0000468078 AGGTCGGTCCTAGCCACCAGCTCA pLX_317 61.8% 90.3% 96% V5 (many diffs) n/a
4 ccsbBroadEn_12813 pDONR223 100% 16.8% 14.4% None (many diffs) n/a
5 ccsbBroad304_12813 pLX_304 0% 16.8% 14.4% V5 (many diffs) n/a
6 TRCN0000469545 AAGACTCTAAACACAAACGATTTG pLX_317 100% 16.8% 14.4% V5 (many diffs) n/a
Download CSV