Transcript: Mouse XM_006527489.3

PREDICTED: Mus musculus cyclin M2 (Cnnm2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnnm2 (94219)
Length:
2183
CDS:
210..2123

Additional Resources:

NCBI RefSeq record:
XM_006527489.3
NBCI Gene record:
Cnnm2 (94219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219595 ATCATCGAGATCGAGATTAAA pLKO.1 723 CDS 100% 15.000 21.000 N Cnnm2 n/a
2 TRCN0000189585 CGCTTCTTATCCGGTTAGCAA pLKO.1 1373 CDS 100% 3.000 4.200 N Cnnm2 n/a
3 TRCN0000189919 GCAAGTGATCTTCATCTCGCT pLKO.1 980 CDS 100% 0.660 0.924 N Cnnm2 n/a
4 TRCN0000452962 CGCTATGCTGGAAGAATTTAA pLKO_005 1805 CDS 100% 15.000 12.000 N CNNM2 n/a
5 TRCN0000192479 CCTGCTCTTTGTCAAAGACTT pLKO.1 1688 CDS 100% 4.950 3.465 N Cnnm2 n/a
6 TRCN0000189856 GCATCGTCATCTTCGGAGAAA pLKO.1 1261 CDS 100% 4.950 3.465 N Cnnm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08409 pDONR223 100% 80% 82% None (many diffs) n/a
2 ccsbBroad304_08409 pLX_304 0% 80% 82% V5 (many diffs) n/a
3 TRCN0000480940 CATGTGCACTTAGTAGCCCGGATT pLX_317 24.7% 80% 82% V5 (many diffs) n/a
Download CSV