Transcript: Mouse XM_006527546.2

PREDICTED: Mus musculus nudix (nucleoside diphosphate linked moiety X)-type motif 10 (Nudt10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nudt10 (102954)
Length:
1064
CDS:
210..704

Additional Resources:

NCBI RefSeq record:
XM_006527546.2
NBCI Gene record:
Nudt10 (102954)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177917 CAAGATCGAAGATGCCATCAA pLKO.1 569 CDS 100% 4.950 2.475 Y Nudt10 n/a
2 TRCN0000081509 GAGTGGTTCAAGATCGAAGAT pLKO.1 561 CDS 100% 4.950 2.475 Y Nudt11 n/a
3 TRCN0000178415 GTTCAAGATCGAAGATGCCAT pLKO.1 566 CDS 100% 2.640 1.320 Y Nudt10 n/a
4 TRCN0000081510 CACGCCGAGTACCTGGAGAAA pLKO.1 615 CDS 100% 1.650 0.825 Y Nudt11 n/a
5 TRCN0000081512 GCACCGGACCTACGTGTTCGT pLKO.1 479 CDS 100% 0.000 0.000 Y Nudt11 n/a
6 TRCN0000081511 GCTGGGCGTCTTCGAGCAGAA pLKO.1 446 CDS 100% 0.000 0.000 Y Nudt11 n/a
7 TRCN0000200436 GTACCTGGAGAAACTGAAGCT pLKO.1 623 CDS 100% 0.000 0.000 Y Nudt10 n/a
8 TRCN0000050306 TGCTGGAGGATTGGGAAGATT pLKO.1 517 CDS 100% 5.625 2.813 Y NUDT11 n/a
9 TRCN0000327651 TGCTGGAGGATTGGGAAGATT pLKO_005 517 CDS 100% 5.625 2.813 Y NUDT11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16119 pDONR223 0% 87.8% 94.5% None (many diffs) n/a
2 ccsbBroad304_16119 pLX_304 0% 87.8% 94.5% V5 (many diffs) n/a
3 TRCN0000468380 TTCAACATATTGCCGCGCTGGCAA pLX_317 79.2% 87.8% 94.5% V5 (many diffs) n/a
4 ccsbBroadEn_09782 pDONR223 100% 87.3% 94.5% None (many diffs) n/a
5 ccsbBroad304_09782 pLX_304 0% 87.3% 94.5% V5 (many diffs) n/a
6 TRCN0000471165 TCGTGAAGCGCCATCCACTGCGAA pLX_317 92.3% 87.3% 94.5% V5 (many diffs) n/a
7 ccsbBroadEn_08486 pDONR223 100% 87.3% 94.5% None (many diffs) n/a
8 ccsbBroad304_08486 pLX_304 0% 87.3% 94.5% V5 (many diffs) n/a
9 TRCN0000471707 AATGTGCACGACCTAGGGATGGTG pLX_317 55% 87.3% 94.5% V5 (many diffs) n/a
Download CSV