Transcript: Mouse XM_006527624.3

PREDICTED: Mus musculus G protein-coupled receptor 34 (Gpr34), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr34 (23890)
Length:
3289
CDS:
1664..2791

Additional Resources:

NCBI RefSeq record:
XM_006527624.3
NBCI Gene record:
Gpr34 (23890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527624.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357163 ATCAGTTTGGATCGCTATATA pLKO_005 2084 CDS 100% 15.000 21.000 N GPR34 n/a
2 TRCN0000027482 CCGCATAATGTATCACATCAA pLKO.1 1969 CDS 100% 4.950 6.930 N Gpr34 n/a
3 TRCN0000027487 CCTCTCATGGAATGCACTTTA pLKO.1 1698 CDS 100% 13.200 9.240 N Gpr34 n/a
4 TRCN0000357164 GAACATGTACATTAGCATTAT pLKO_005 2050 CDS 100% 13.200 9.240 N GPR34 n/a
5 TRCN0000027439 CCTACTGATAATCCTCTCATA pLKO.1 2335 CDS 100% 4.950 3.465 N Gpr34 n/a
6 TRCN0000027412 CCTCTTGTTATTGGAAGGAAA pLKO.1 2532 CDS 100% 4.950 3.465 N Gpr34 n/a
7 TRCN0000027451 CCAGTACAGCACTAAGGGTAA pLKO.1 2767 CDS 100% 4.050 2.835 N Gpr34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527624.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00677 pDONR223 100% 85.6% 89.5% None (many diffs) n/a
2 ccsbBroad304_00677 pLX_304 0% 85.6% 89.5% V5 (many diffs) n/a
3 TRCN0000472965 CGGACGCTATGATTTTTACCGCAA pLX_317 46.1% 85.6% 89.5% V5 (many diffs) n/a
4 TRCN0000489826 CCAATCAAACTGCCATCTCCTAGC pLX_317 35.8% 85.5% 89.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000492042 CAATCACCTTTTAATGAAATTTGT pLX_317 21.5% 85.4% 89.2% V5 (many diffs) n/a
Download CSV