Transcript: Mouse XM_006527985.3

PREDICTED: Mus musculus phosphate cytidylyltransferase 1, choline, beta isoform (Pcyt1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcyt1b (236899)
Length:
4745
CDS:
176..1225

Additional Resources:

NCBI RefSeq record:
XM_006527985.3
NBCI Gene record:
Pcyt1b (236899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527985.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111345 CCAGGTACAAACAGACACTTA pLKO.1 3432 3UTR 100% 4.950 3.960 N Pcyt1b n/a
2 TRCN0000111349 CGCTTAGGAACACCAGTTGAT pLKO.1 317 CDS 100% 4.950 3.465 N Pcyt1b n/a
3 TRCN0000111347 GCTACTTGTTGGTAGGAGTTT pLKO.1 432 CDS 100% 4.950 3.465 N Pcyt1b n/a
4 TRCN0000111348 CCTGTTAGAGTGTATGCAGAT pLKO.1 341 CDS 100% 4.050 2.835 N Pcyt1b n/a
5 TRCN0000111346 GCATGTTTGTTCCAACACAAA pLKO.1 681 CDS 100% 0.495 0.347 N Pcyt1b n/a
6 TRCN0000035679 CCCAACAGCTACTTGTTGGTA pLKO.1 425 CDS 100% 0.300 0.210 N PCYT1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527985.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07421 pDONR223 100% 86.7% 92.3% None (many diffs) n/a
2 ccsbBroad304_07421 pLX_304 0% 86.7% 92.3% V5 (many diffs) n/a
3 TRCN0000478025 GTACACCGCTTATTTCTGACAATA pLX_317 21.7% 86.7% 92.3% V5 (many diffs) n/a
Download CSV