Transcript: Mouse XM_006528487.3

PREDICTED: Mus musculus claudin 2 (Cldn2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cldn2 (12738)
Length:
1921
CDS:
385..1149

Additional Resources:

NCBI RefSeq record:
XM_006528487.3
NBCI Gene record:
Cldn2 (12738)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528487.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337647 ATGTCCTCGCTGGCTTGTATT pLKO_005 652 CDS 100% 13.200 18.480 N Cldn2 n/a
2 TRCN0000337717 GCAATCGTACCAACTACTATG pLKO_005 950 CDS 100% 10.800 15.120 N Cldn2 n/a
3 TRCN0000091499 GCGATATCTACAGTACCCTTT pLKO.1 575 CDS 100% 4.050 5.670 N Cldn2 n/a
4 TRCN0000091501 GTTAGGCACATCCATTGCCAT pLKO.1 438 CDS 100% 2.640 3.696 N Cldn2 n/a
5 TRCN0000337651 TGGTTCCTGACAGCATGAAAT pLKO_005 836 CDS 100% 13.200 9.240 N Cldn2 n/a
6 TRCN0000433252 ACAGCATGAAATTTGAGATTG pLKO_005 845 CDS 100% 10.800 7.560 N CLDN2 n/a
7 TRCN0000337648 AGGCATCACCCAGTGCGATAT pLKO_005 561 CDS 100% 10.800 7.560 N Cldn2 n/a
8 TRCN0000091500 CAAGAGTGAGTTCAACTCATA pLKO.1 1035 CDS 100% 4.950 3.465 N Cldn2 n/a
9 TRCN0000091502 GCCGGAGTCATCCTTTGCTTT pLKO.1 913 CDS 100% 4.950 3.465 N Cldn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528487.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14013 pDONR223 100% 77.7% 2.3% None (many diffs) n/a
2 ccsbBroad304_14013 pLX_304 0% 77.7% 2.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471958 TAAAAAGCCTGGGATATAAAGATA pLX_317 60.7% 77.7% 2.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV