Transcript: Mouse XM_006529427.2

PREDICTED: Mus musculus dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Dyrk3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dyrk3 (226419)
Length:
1988
CDS:
100..1755

Additional Resources:

NCBI RefSeq record:
XM_006529427.2
NBCI Gene record:
Dyrk3 (226419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362159 AGACCTGTATGAGCTTATTAA pLKO_005 870 CDS 100% 15.000 21.000 N Dyrk3 n/a
2 TRCN0000362086 CGGGTAGTTAACCCTACAAAT pLKO_005 1606 CDS 100% 13.200 18.480 N Dyrk3 n/a
3 TRCN0000362079 TCCGAAACCAGTGGTAGTATA pLKO_005 1699 CDS 100% 13.200 18.480 N Dyrk3 n/a
4 TRCN0000023125 GCGGGTAGTTAACCCTACAAA pLKO.1 1605 CDS 100% 5.625 7.875 N Dyrk3 n/a
5 TRCN0000362162 TCAGAAGCTTTACACGTATAT pLKO_005 1080 CDS 100% 13.200 10.560 N Dyrk3 n/a
6 TRCN0000362080 ACTACTTGTTCATAGAGTTTC pLKO_005 1466 CDS 100% 10.800 8.640 N Dyrk3 n/a
7 TRCN0000362161 CAAGCGCTGAAGCAGTATAAA pLKO_005 424 CDS 100% 15.000 10.500 N Dyrk3 n/a
8 TRCN0000362158 CCAAGCGTGCCAAGTACTTTA pLKO_005 1298 CDS 100% 13.200 9.240 N Dyrk3 n/a
9 TRCN0000362083 ACTCAGAGACTGATACATATC pLKO_005 1762 3UTR 100% 10.800 7.560 N Dyrk3 n/a
10 TRCN0000023127 CCCACCCTATTCGGACACATT pLKO.1 123 CDS 100% 4.950 3.465 N Dyrk3 n/a
11 TRCN0000023128 GCATTAAGACATCCTTGGATT pLKO.1 1537 CDS 100% 4.950 3.465 N Dyrk3 n/a
12 TRCN0000023124 GCCTGCATGATAGAGTTGCTA pLKO.1 1246 CDS 100% 3.000 2.100 N Dyrk3 n/a
13 TRCN0000023126 GCTTCGAGTATCAGAAGCTTT pLKO.1 1070 CDS 100% 0.495 0.347 N Dyrk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489870 CTTTACCTAAGATGTTAGGCTCAT pLX_317 25.3% 84.8% 89.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_07240 pDONR223 100% 82.5% 87.3% None (many diffs) n/a
3 ccsbBroad304_07240 pLX_304 0% 82.5% 87.3% V5 (many diffs) n/a
4 TRCN0000465369 GCCACGCCGAGCGCAGACTGGTCG pLX_317 20.1% 82.5% 87.3% V5 (many diffs) n/a
5 ccsbBroadEn_14894 pDONR223 0% 82.5% 87.3% None (many diffs) n/a
6 ccsbBroad304_14894 pLX_304 0% 82.5% 87.3% V5 (many diffs) n/a
7 TRCN0000473061 ATCAGCGTATACCTCCCCGCCGTT pLX_317 24.3% 82.5% 87.3% V5 (many diffs) n/a
8 TRCN0000488254 CGTATGGTGGTGTCTAAAAGTCGA pLX_317 19.9% 79.8% 84.5% V5 (many diffs) n/a
Download CSV