Transcript: Mouse XM_006529429.3

PREDICTED: Mus musculus RAB7B, member RAS oncogene family (Rab7b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab7b (226421)
Length:
4566
CDS:
173..820

Additional Resources:

NCBI RefSeq record:
XM_006529429.3
NBCI Gene record:
Rab7b (226421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312901 GGGCGACTGAGAACCATAATC pLKO_005 1292 3UTR 100% 13.200 18.480 N Rab7b n/a
2 TRCN0000312893 CGCTCAATGGTATCAACATTC pLKO_005 557 CDS 100% 10.800 15.120 N Rab7b n/a
3 TRCN0000100655 CGCAGCAAATAGTATGTGTTT pLKO.1 2436 3UTR 100% 4.950 3.960 N Rab7b n/a
4 TRCN0000374411 ATGATGTCCTGGCAAAGATTA pLKO_005 657 CDS 100% 13.200 9.240 N Rab7b n/a
5 TRCN0000374412 CATGACTCAAGCTCCTCTTTC pLKO_005 970 3UTR 100% 10.800 7.560 N Rab7b n/a
6 TRCN0000100657 GATGGCTGTATCCTGGCATTT pLKO.1 590 CDS 100% 10.800 7.560 N Rab7b n/a
7 TRCN0000311914 GATGGCTGTATCCTGGCATTT pLKO_005 590 CDS 100% 10.800 7.560 N Rab7b n/a
8 TRCN0000100656 CCGCTCAATGGTATCAACATT pLKO.1 556 CDS 100% 5.625 3.938 N Rab7b n/a
9 TRCN0000100659 CTGGCATTTGATGTTACTGAT pLKO.1 602 CDS 100% 4.950 3.465 N Rab7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05437 pDONR223 100% 52.6% 54.8% None (many diffs) n/a
2 ccsbBroad304_05437 pLX_304 0% 52.6% 54.8% V5 (many diffs) n/a
3 TRCN0000480492 GAGTTGGTACACAGAGCCTTCACA pLX_317 70.9% 52.6% 54.8% V5 (many diffs) n/a
Download CSV