Transcript: Mouse XM_006529531.3

PREDICTED: Mus musculus phosphoinositide-3-kinase, class 2, beta polypeptide (Pik3c2b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pik3c2b (240752)
Length:
7742
CDS:
311..5209

Additional Resources:

NCBI RefSeq record:
XM_006529531.3
NBCI Gene record:
Pik3c2b (240752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025022 CGAACCTATACTTCTCGATAT pLKO.1 1166 CDS 100% 10.800 15.120 N Pik3c2b n/a
2 TRCN0000025020 GCCATGAGTATATCCAATATT pLKO.1 1635 CDS 100% 15.000 12.000 N Pik3c2b n/a
3 TRCN0000360942 GGGTTCCTCTGAAGCGAATAA pLKO_005 2461 CDS 100% 13.200 10.560 N Pik3c2b n/a
4 TRCN0000024739 GCTGTGGGAGAAACGCTATTA pLKO.1 2821 CDS 100% 13.200 9.240 N LOC329248 n/a
5 TRCN0000360890 CAATGACAACATCATGCTAAA pLKO_005 3898 CDS 100% 10.800 7.560 N Pik3c2b n/a
6 TRCN0000025023 CAGCACATTCAATGCAGACTT pLKO.1 2110 CDS 100% 4.950 3.465 N Pik3c2b n/a
7 TRCN0000024742 CAGCGCAAACTTAAAGACATT pLKO.1 2753 CDS 100% 4.950 3.465 N LOC329248 n/a
8 TRCN0000024743 CGAGAACATCAGAGTCATCTT pLKO.1 3532 CDS 100% 4.950 3.465 N LOC329248 n/a
9 TRCN0000025021 CGATGGCATCAATGATGCAAT pLKO.1 991 CDS 100% 4.950 3.465 N Pik3c2b n/a
10 TRCN0000025019 GCCTAATGACATCAACAGTTT pLKO.1 862 CDS 100% 4.950 3.465 N Pik3c2b n/a
11 TRCN0000024740 CGACATACATCCAGAGGACAT pLKO.1 4503 CDS 100% 4.050 2.835 N LOC329248 n/a
12 TRCN0000024741 CGCACAGATGTTTGGTAACAT pLKO.1 3967 CDS 100% 0.563 0.394 N LOC329248 n/a
13 TRCN0000360889 CTTCATCATGGTGATGCATAT pLKO_005 4864 CDS 100% 10.800 6.480 N Pik3c2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.