Transcript: Mouse XM_006529976.2

PREDICTED: Mus musculus tRNA methyltransferase 1 like (Trmt1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trmt1l (98685)
Length:
2559
CDS:
331..2454

Additional Resources:

NCBI RefSeq record:
XM_006529976.2
NBCI Gene record:
Trmt1l (98685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126966 CGGTGCAACAAAGGTATAGAA pLKO.1 1648 CDS 100% 5.625 7.875 N Trmt1l n/a
2 TRCN0000295563 TGGTAGTTGTGAGGGTCTTAA pLKO_005 1703 CDS 100% 13.200 9.240 N Trmt1l n/a
3 TRCN0000126967 GCCACTGGAATAATGGGATTA pLKO.1 1174 CDS 100% 10.800 7.560 N Trmt1l n/a
4 TRCN0000126968 GCACAGCATCAAAGGGATGAA pLKO.1 2172 CDS 100% 4.950 3.465 N Trmt1l n/a
5 TRCN0000126965 GCCAGTTCATTGAACTCAGAT pLKO.1 634 CDS 100% 4.950 3.465 N Trmt1l n/a
6 TRCN0000288273 GCCAGTTCATTGAACTCAGAT pLKO_005 634 CDS 100% 4.950 3.465 N Trmt1l n/a
7 TRCN0000126964 GTTCTTCTCAGGGTTCTGTAT pLKO.1 2465 3UTR 100% 4.950 3.465 N Trmt1l n/a
8 TRCN0000288207 GTTCTTCTCAGGGTTCTGTAT pLKO_005 2465 3UTR 100% 4.950 3.465 N Trmt1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04250 pDONR223 100% 83.4% 85.4% None (many diffs) n/a
2 ccsbBroad304_04250 pLX_304 0% 83.4% 85.4% V5 (many diffs) n/a
3 TRCN0000491498 CGCCAGCAGACATGCGTCGCACAT pLX_317 14.3% 83.4% 85.4% V5 (many diffs) n/a
Download CSV