Transcript: Mouse XM_006530129.3

PREDICTED: Mus musculus intraflagellar transport 81 (Ift81), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ift81 (12589)
Length:
2860
CDS:
232..2043

Additional Resources:

NCBI RefSeq record:
XM_006530129.3
NBCI Gene record:
Ift81 (12589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530129.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250460 CGCATCTGCGTAACGTGATTT pLKO_005 2068 3UTR 100% 13.200 18.480 N Ift81 n/a
2 TRCN0000250459 TTCAAGCGATACGTCAGTAAA pLKO_005 1201 CDS 100% 13.200 18.480 N Ift81 n/a
3 TRCN0000191366 CGAACTTGAGACTAAAGTCAA pLKO.1 942 CDS 100% 4.950 6.930 N Ift81 n/a
4 TRCN0000217456 GCCGTAGCTGTTGATCTTAAA pLKO.1 2545 3UTR 100% 13.200 9.240 N Ift81 n/a
5 TRCN0000250463 GGCAACAGGCATCCATCATTT pLKO_005 1046 CDS 100% 13.200 9.240 N Ift81 n/a
6 TRCN0000250462 TGGCTTCTTCAGCGGAGTAAT pLKO_005 322 CDS 100% 13.200 9.240 N Ift81 n/a
7 TRCN0000192134 GCACAACAGAAACAGGAACAA pLKO.1 679 CDS 100% 4.950 3.465 N Ift81 n/a
8 TRCN0000250461 TTTGGGACCAATGCAACTATT pLKO_005 200 5UTR 100% 13.200 7.920 N Ift81 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530129.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03054 pDONR223 100% 44.9% 43.4% None (many diffs) n/a
2 ccsbBroad304_03054 pLX_304 0% 44.9% 43.4% V5 (many diffs) n/a
3 TRCN0000480355 CTTCTCTTCATGCTTACGGGAGCT pLX_317 29% 44.9% 43.4% V5 (many diffs) n/a
4 ccsbBroadEn_15801 pDONR223 0% 15.4% 16.2% None (many diffs) n/a
5 ccsbBroad304_15801 pLX_304 0% 15.4% 16.2% V5 (many diffs) n/a
Download CSV