Transcript: Mouse XM_006530244.3

PREDICTED: Mus musculus arginine/serine-rich coiled-coil 2 (Rsrc2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rsrc2 (208606)
Length:
2198
CDS:
287..1447

Additional Resources:

NCBI RefSeq record:
XM_006530244.3
NBCI Gene record:
Rsrc2 (208606)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252079 AGTCGAAGTCGAGATAGAAAG pLKO_005 734 CDS 100% 10.800 8.640 N Rsrc2 n/a
2 TRCN0000191666 GCGATTAAATTCATCTGAGAA pLKO.1 442 CDS 100% 4.950 3.960 N Rsrc2 n/a
3 TRCN0000130541 GCTCAGTATGAAATGGCAAGA pLKO.1 1355 CDS 100% 4.050 3.240 N RSRC2 n/a
4 TRCN0000352934 GCTCAGTATGAAATGGCAAGA pLKO_005 1355 CDS 100% 4.050 3.240 N RSRC2 n/a
5 TRCN0000252082 ACAAAGGAAGAGAGCGATTAA pLKO_005 429 CDS 100% 13.200 9.240 N Rsrc2 n/a
6 TRCN0000252081 CTGAGGAGCACAATGACAAAG pLKO_005 396 CDS 100% 10.800 7.560 N Rsrc2 n/a
7 TRCN0000131075 GCATGGGTGTTGCATTGACTT pLKO.1 1525 3UTR 100% 4.950 3.465 N RSRC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489543 ACACCATGAACCACCTGATCTCCA pLX_317 28.9% 72% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV