Transcript: Mouse XM_006530317.3

PREDICTED: Mus musculus strawberry notch homolog 1 (Drosophila) (Sbno1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sbno1 (243272)
Length:
7848
CDS:
229..4404

Additional Resources:

NCBI RefSeq record:
XM_006530317.3
NBCI Gene record:
Sbno1 (243272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253434 ACAATAGCAGGGATCATATAT pLKO_005 1213 CDS 100% 15.000 21.000 N Sbno1 n/a
2 TRCN0000253433 CTGAAGCCACCCGCCAATATT pLKO_005 730 CDS 100% 15.000 21.000 N Sbno1 n/a
3 TRCN0000253431 GCATGGGTTTCAAGTCTAAAT pLKO_005 4830 3UTR 100% 13.200 18.480 N Sbno1 n/a
4 TRCN0000253430 TACACTGGCTGGATCAGTATA pLKO_005 4013 CDS 100% 13.200 18.480 N Sbno1 n/a
5 TRCN0000253432 TGATAGGAGTGGGCTTGATTA pLKO_005 3458 CDS 100% 13.200 9.240 N Sbno1 n/a
6 TRCN0000144930 GAAGAAGAAGATGAGGAAGAA pLKO.1 910 CDS 100% 4.950 2.475 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488167 CAGGTCATATCCGCTCTCATTATG pLX_317 36.5% 17.7% 19.9% V5 (many diffs) n/a
2 TRCN0000487978 ACGATCAAACATCGATTTGACGCC pLX_317 39.2% 17.7% 19.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13789 pDONR223 100% 11.4% 10.6% None (many diffs) n/a
4 ccsbBroad304_13789 pLX_304 0% 11.4% 10.6% V5 (many diffs) n/a
5 TRCN0000475304 ACTTTCCTTACCCGCGCTCCAGGC pLX_317 77.6% 11.4% 10.6% V5 (many diffs) n/a
Download CSV