Transcript: Mouse XM_006530537.4

PREDICTED: Mus musculus phosphorylase kinase beta (Phkb), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Phkb (102093)
Length:
8298
CDS:
904..3489

Additional Resources:

NCBI RefSeq record:
XM_006530537.4
NBCI Gene record:
Phkb (102093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530537.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025080 CCAGCCAAAGTATAGACAGAT pLKO.1 3180 CDS 100% 4.950 6.930 N Phkb n/a
2 TRCN0000345017 CCAGCCAAAGTATAGACAGAT pLKO_005 3180 CDS 100% 4.950 6.930 N Phkb n/a
3 TRCN0000025081 CGCACACCTAATGGTATCGTT pLKO.1 3058 CDS 100% 3.000 4.200 N Phkb n/a
4 TRCN0000345016 CGCACACCTAATGGTATCGTT pLKO_005 3058 CDS 100% 3.000 4.200 N Phkb n/a
5 TRCN0000025082 GCACTACAGTTCATTAAGCAA pLKO.1 2008 CDS 100% 3.000 4.200 N Phkb n/a
6 TRCN0000345015 GCACTACAGTTCATTAAGCAA pLKO_005 2008 CDS 100% 3.000 4.200 N Phkb n/a
7 TRCN0000025079 GCTCACTGTTACCCAGAGAAT pLKO.1 1046 CDS 100% 4.950 3.465 N Phkb n/a
8 TRCN0000345014 GCTCACTGTTACCCAGAGAAT pLKO_005 1046 CDS 100% 4.950 3.465 N Phkb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530537.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14754 pDONR223 0% 70% 73.5% None (many diffs) n/a
2 ccsbBroad304_14754 pLX_304 0% 70% 73.5% V5 (many diffs) n/a
3 TRCN0000474290 CTTATGACAAAAGCCCCCCGACTC pLX_317 13.7% 70% 73.5% V5 (many diffs) n/a
4 ccsbBroadEn_14753 pDONR223 74.1% 69.9% 73.2% None (many diffs) n/a
5 ccsbBroad304_14753 pLX_304 0% 69.9% 73.2% V5 (many diffs) n/a
6 TRCN0000478777 TGTCCCTAGTTAATCGCTATTCCA pLX_317 9.7% 69.9% 73.2% V5 (many diffs) n/a
Download CSV