Transcript: Mouse XM_006530559.2

PREDICTED: Mus musculus glutamic pyruvate transaminase (alanine aminotransferase) 2 (Gpt2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpt2 (108682)
Length:
4823
CDS:
2017..2889

Additional Resources:

NCBI RefSeq record:
XM_006530559.2
NBCI Gene record:
Gpt2 (108682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530559.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281767 ATTCTCCCTCCGGTGGATAAA pLKO_005 2806 CDS 100% 13.200 18.480 N Gpt2 n/a
2 TRCN0000119732 GCTAGGCATATAATCCAGATA pLKO.1 4241 3UTR 100% 4.950 6.930 N Gpt2 n/a
3 TRCN0000271739 GGAGTAGAGGGTTAGTATTTA pLKO_005 4359 3UTR 100% 15.000 10.500 N Gpt2 n/a
4 TRCN0000271695 TGCAGATTCCACTCGTTTAAG pLKO_005 2248 CDS 100% 13.200 9.240 N Gpt2 n/a
5 TRCN0000119735 GCTCCACAAGGTGAAAGACTT pLKO.1 2838 CDS 100% 4.950 3.465 N Gpt2 n/a
6 TRCN0000035028 GACAACGTGTACTCTCCAGAT pLKO.1 2227 CDS 100% 4.050 3.240 N GPT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530559.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04417 pDONR223 100% 48.2% 45.1% None (many diffs) n/a
2 ccsbBroad304_04417 pLX_304 0% 48.2% 45.1% V5 (many diffs) n/a
3 TRCN0000492245 TGCCCCCTTGAGTGATGTTAGTGA pLX_317 27.4% 48.2% 45.1% V5 (many diffs) n/a
Download CSV