Transcript: Mouse XM_006530868.1

PREDICTED: Mus musculus N-myc downstream regulated gene 4 (Ndrg4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ndrg4 (234593)
Length:
3240
CDS:
441..1616

Additional Resources:

NCBI RefSeq record:
XM_006530868.1
NBCI Gene record:
Ndrg4 (234593)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238103 ATGACATCGAGACGCCTTATG pLKO_005 622 CDS 100% 10.800 15.120 N Ndrg4 n/a
2 TRCN0000238106 TAGATAGCACTCCAAGTATTG pLKO_005 2917 3UTR 100% 10.800 15.120 N Ndrg4 n/a
3 TRCN0000238102 GATGCTGGTAGTCGGAGATAA pLKO_005 1283 CDS 100% 13.200 10.560 N Ndrg4 n/a
4 TRCN0000238104 TTGGGTTTAAGTACGTGATTG pLKO_005 904 CDS 100% 10.800 7.560 N Ndrg4 n/a
5 TRCN0000138639 CATCCTCACCTACCATGATGT pLKO.1 692 CDS 100% 4.950 3.465 N NDRG4 n/a
6 TRCN0000137216 GCTCTTCTGGAACATGTACAA pLKO.1 1193 CDS 100% 4.950 3.465 N NDRG4 n/a
7 TRCN0000238105 GCCGCAGAGACCTTGATATTA pLKO_005 1216 CDS 100% 15.000 9.000 N Ndrg4 n/a
8 TRCN0000138040 GCAGCTCTTCTGGAACATGTA pLKO.1 1190 CDS 100% 4.950 2.970 N NDRG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12508 pDONR223 100% 78.5% 83.1% None (many diffs) n/a
2 ccsbBroad304_12508 pLX_304 0% 78.5% 83.1% V5 (many diffs) n/a
3 TRCN0000471852 TGATTCATGTCCCCATCGGCCGGG pLX_317 50.4% 78.5% 83.1% V5 (many diffs) n/a
Download CSV