Transcript: Mouse XM_006530869.1

PREDICTED: Mus musculus N-myc downstream regulated gene 4 (Ndrg4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ndrg4 (234593)
Length:
3129
CDS:
351..1505

Additional Resources:

NCBI RefSeq record:
XM_006530869.1
NBCI Gene record:
Ndrg4 (234593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238103 ATGACATCGAGACGCCTTATG pLKO_005 472 CDS 100% 10.800 15.120 N Ndrg4 n/a
2 TRCN0000238106 TAGATAGCACTCCAAGTATTG pLKO_005 2806 3UTR 100% 10.800 15.120 N Ndrg4 n/a
3 TRCN0000238102 GATGCTGGTAGTCGGAGATAA pLKO_005 1133 CDS 100% 13.200 10.560 N Ndrg4 n/a
4 TRCN0000238104 TTGGGTTTAAGTACGTGATTG pLKO_005 754 CDS 100% 10.800 7.560 N Ndrg4 n/a
5 TRCN0000138639 CATCCTCACCTACCATGATGT pLKO.1 542 CDS 100% 4.950 3.465 N NDRG4 n/a
6 TRCN0000137216 GCTCTTCTGGAACATGTACAA pLKO.1 1043 CDS 100% 4.950 3.465 N NDRG4 n/a
7 TRCN0000238105 GCCGCAGAGACCTTGATATTA pLKO_005 1066 CDS 100% 15.000 9.000 N Ndrg4 n/a
8 TRCN0000138040 GCAGCTCTTCTGGAACATGTA pLKO.1 1040 CDS 100% 4.950 2.970 N NDRG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12508 pDONR223 100% 80% 84.4% None (many diffs) n/a
2 ccsbBroad304_12508 pLX_304 0% 80% 84.4% V5 (many diffs) n/a
3 TRCN0000471852 TGATTCATGTCCCCATCGGCCGGG pLX_317 50.4% 80% 84.4% V5 (many diffs) n/a
Download CSV