Transcript: Mouse XM_006530887.2

PREDICTED: Mus musculus RIKEN cDNA D230025D16 gene (D230025D16Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
D230025D16Rik (234678)
Length:
3003
CDS:
276..1634

Additional Resources:

NCBI RefSeq record:
XM_006530887.2
NBCI Gene record:
D230025D16Rik (234678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160023 CCACACAAAGTCTTCTATAAA pLKO.1 1038 CDS 100% 15.000 21.000 N C16orf70 n/a
2 TRCN0000277387 GTAGTACTTGGTTGCAATATT pLKO_005 2061 3UTR 100% 15.000 21.000 N D230025D16Rik n/a
3 TRCN0000277389 ATTTGAGCGTGCGGTGTATTT pLKO_005 977 CDS 100% 13.200 18.480 N D230025D16Rik n/a
4 TRCN0000181298 CGGTAGTACTTGGTTGCAATA pLKO.1 2059 3UTR 100% 10.800 15.120 N D230025D16Rik n/a
5 TRCN0000177899 CCTAAGTGGATGAAATCGTTT pLKO.1 2187 3UTR 100% 4.950 6.930 N D230025D16Rik n/a
6 TRCN0000182875 CCTCATCCTTAACCTGACTCA pLKO.1 440 CDS 100% 2.640 3.696 N D230025D16Rik n/a
7 TRCN0000277390 CCTCATCCTTAACCTGACTCA pLKO_005 440 CDS 100% 2.640 3.696 N D230025D16Rik n/a
8 TRCN0000416116 ATTACCCTGGGCATTATAATT pLKO_005 1210 CDS 100% 15.000 10.500 N C16orf70 n/a
9 TRCN0000277316 GTTTGTCCTGCATACCAATTA pLKO_005 1193 CDS 100% 13.200 9.240 N D230025D16Rik n/a
10 TRCN0000182833 CCAGAGACTCAAGGTGATTGA pLKO.1 494 CDS 100% 4.950 3.465 N D230025D16Rik n/a
11 TRCN0000277388 CCAGAGACTCAAGGTGATTGA pLKO_005 494 CDS 100% 4.950 3.465 N D230025D16Rik n/a
12 TRCN0000181444 CCATTGAGCAAATTGACCAGT pLKO.1 586 CDS 100% 2.640 1.848 N D230025D16Rik n/a
13 TRCN0000200247 CATACCAATTACCCTGGGCAT pLKO.1 1203 CDS 100% 2.160 1.512 N D230025D16Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04198 pDONR223 100% 85.9% 90.4% None (many diffs) n/a
2 ccsbBroad304_04198 pLX_304 0% 85.9% 90.4% V5 (many diffs) n/a
3 TRCN0000480083 GCGGAGGCGCGCTACTGTGAGAAA pLX_317 27.3% 85.9% 90.4% V5 (many diffs) n/a
Download CSV