Transcript: Mouse XM_006531396.1

PREDICTED: Mus musculus hydroxysteroid dehydrogenase like 1 (Hsdl1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hsdl1 (72552)
Length:
3278
CDS:
225..1217

Additional Resources:

NCBI RefSeq record:
XM_006531396.1
NBCI Gene record:
Hsdl1 (72552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113334 AGTTCCTCTTCGCACAGTATA pLKO.1 1117 CDS 100% 13.200 10.560 N Hsdl1 n/a
2 TRCN0000113330 GCGTGGTATAAGGTAGTTATT pLKO.1 2295 3UTR 100% 13.200 10.560 N Hsdl1 n/a
3 TRCN0000113333 CCTTACGGAAAGAGGCCTTAT pLKO.1 1183 CDS 100% 10.800 8.640 N Hsdl1 n/a
4 TRCN0000113332 GCAGTACGAGTATGCCTCTAA pLKO.1 920 CDS 100% 4.950 3.465 N Hsdl1 n/a
5 TRCN0000113331 CGGACTCAATGTCATCCTGAT pLKO.1 494 CDS 100% 4.050 2.835 N Hsdl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04287 pDONR223 100% 81.3% 87.8% None (many diffs) n/a
2 ccsbBroad304_04287 pLX_304 0% 81.3% 87.8% V5 (many diffs) n/a
3 TRCN0000468351 ACCTTCGTCACTCGAACTACTACG pLX_317 35.8% 81.3% 87.8% V5 (many diffs) n/a
Download CSV