Transcript: Mouse XM_006532125.2

PREDICTED: Mus musculus v-crk avian sarcoma virus CT10 oncogene homolog (Crk), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crk (12928)
Length:
1433
CDS:
177..962

Additional Resources:

NCBI RefSeq record:
XM_006532125.2
NBCI Gene record:
Crk (12928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042603 CGAATAGGAGATCAAGAATTT pLKO.1 438 CDS 100% 13.200 18.480 N Crk n/a
2 TRCN0000042605 CATCCTGAGAATCCGGGATAA pLKO.1 647 CDS 100% 10.800 15.120 N Crk n/a
3 TRCN0000021845 CGCCTCAGTATCGGCTCTGAT pLKO.1 758 CDS 100% 1.650 2.310 N CRK n/a
4 TRCN0000281380 CGCCTCAGTATCGGCTCTGAT pLKO_005 758 CDS 100% 1.650 2.310 N CRK n/a
5 TRCN0000321844 TATTTGGACACTACAACATTG pLKO_005 498 CDS 100% 10.800 7.560 N Crk n/a
6 TRCN0000021848 CCTCTTTGACTTTAATGGGAA pLKO.1 593 CDS 100% 2.640 1.848 N CRK n/a
7 TRCN0000042607 GCCTGCTTTACTGGAATTCTA pLKO.1 467 CDS 100% 0.000 0.000 N Crk n/a
8 TRCN0000021846 GCTTTACTGGAATTCTACAAA pLKO.1 471 CDS 100% 0.000 0.000 N CRK n/a
9 TRCN0000281302 GCTTTACTGGAATTCTACAAA pLKO_005 471 CDS 100% 0.000 0.000 N CRK n/a
10 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 914 CDS 100% 2.640 1.320 Y Adsl n/a
11 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 914 CDS 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15388 pDONR223 0% 73.8% 77% None (many diffs) n/a
2 ccsbBroadEn_06038 pDONR223 100% 72.5% 65% None (many diffs) n/a
3 ccsbBroad304_06038 pLX_304 0% 72.5% 65% V5 (many diffs) n/a
4 TRCN0000469357 TGTCATACTTCCAAGAGTACCAAC pLX_317 46% 72.5% 65% V5 (many diffs) n/a
Download CSV