Transcript: Mouse XM_006532342.1

PREDICTED: Mus musculus LIM and SH3 protein 1 (Lasp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lasp1 (16796)
Length:
3375
CDS:
172..855

Additional Resources:

NCBI RefSeq record:
XM_006532342.1
NBCI Gene record:
Lasp1 (16796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075566 GTGCGCTACAAGGAGGAATTT pLKO.1 313 CDS 100% 13.200 10.560 N Lasp1 n/a
2 TRCN0000075563 GCCTGGTCAATCCCTTTACTT pLKO.1 2433 3UTR 100% 5.625 4.500 N Lasp1 n/a
3 TRCN0000301417 GCCTGGTCAATCCCTTTACTT pLKO_005 2433 3UTR 100% 5.625 4.500 N Lasp1 n/a
4 TRCN0000075567 GAACTACAAGGGTTATGAGAA pLKO.1 189 CDS 100% 4.950 3.960 N Lasp1 n/a
5 TRCN0000301418 GAACTACAAGGGTTATGAGAA pLKO_005 189 CDS 100% 4.950 3.960 N Lasp1 n/a
6 TRCN0000075565 CCAGGACCAGATCAGCAATAT pLKO.1 402 CDS 100% 13.200 9.240 N Lasp1 n/a
7 TRCN0000301420 CCAGGACCAGATCAGCAATAT pLKO_005 402 CDS 100% 13.200 9.240 N Lasp1 n/a
8 TRCN0000075564 CCTTACTGCAATGCACACTAT pLKO.1 214 CDS 100% 4.950 3.465 N Lasp1 n/a
9 TRCN0000301419 CCTTACTGCAATGCACACTAT pLKO_005 214 CDS 100% 4.950 3.465 N Lasp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06516 pDONR223 100% 77.4% 82.1% None (many diffs) n/a
2 ccsbBroad304_06516 pLX_304 0% 77.4% 82.1% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000466984 AACCGCTAGTGGTACGGCGCCTCA pLX_317 57.9% 77.4% 82.1% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV