Transcript: Mouse XM_006532849.3

PREDICTED: Mus musculus folliculin interacting protein 1 (Fnip1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fnip1 (216742)
Length:
4874
CDS:
153..3566

Additional Resources:

NCBI RefSeq record:
XM_006532849.3
NBCI Gene record:
Fnip1 (216742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192631 GTTACGTTCTTGATTGGAGAT pLKO.1 2319 CDS 100% 4.050 3.240 N Fnip1 n/a
2 TRCN0000128279 GCAGAAGCTGTCTGTATTATA pLKO.1 3198 CDS 100% 15.000 10.500 N FNIP1 n/a
3 TRCN0000239414 GGCAAAGACTCATCCATATAA pLKO_005 1547 CDS 100% 15.000 10.500 N FNIP1 n/a
4 TRCN0000200981 CGTTCTTGATTGGAGATTCTA pLKO.1 2323 CDS 100% 5.625 3.938 N Fnip1 n/a
5 TRCN0000128278 GAATGGGACATTCCAAGAAAT pLKO.1 2853 CDS 100% 13.200 7.920 N FNIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13008 pDONR223 100% 37.9% 39.3% None (many diffs) n/a
2 ccsbBroad304_13008 pLX_304 0% 37.9% 39.3% V5 (many diffs) n/a
3 TRCN0000474728 TGACCGGACACAAAGGTACTTTTC pLX_317 35.5% 37.9% 39.3% V5 (many diffs) n/a
Download CSV