Transcript: Mouse XM_006532969.3

PREDICTED: Mus musculus cDNA sequence BC030499 (BC030499), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
BC030499 (216976)
Length:
2558
CDS:
157..975

Additional Resources:

NCBI RefSeq record:
XM_006532969.3
NBCI Gene record:
BC030499 (216976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532969.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022952 GAGGATTCTATCCGTCTCTTT pLKO.1 343 CDS 100% 4.950 6.930 N BC030499 n/a
2 TRCN0000022953 TGTAACTTGGACAACAGATTT pLKO.1 107 5UTR 100% 13.200 10.560 N BC030499 n/a
3 TRCN0000360789 TATCATCCACCGTGATGTAAA pLKO_005 408 CDS 100% 13.200 9.240 N BC030499 n/a
4 TRCN0000360788 TGGTTTCCAGAGGATTCTATC pLKO_005 334 CDS 100% 10.800 7.560 N BC030499 n/a
5 TRCN0000022949 GCGACAGATCAACCATCCTTT pLKO.1 213 CDS 100% 4.950 3.465 N BC030499 n/a
6 TRCN0000022950 CCATGAGCTCTTATGCCAGAA pLKO.1 741 CDS 100% 4.050 2.835 N BC030499 n/a
7 TRCN0000022951 CCTCTTTATTATGTGTAGCTA pLKO.1 273 CDS 100% 3.000 2.100 N BC030499 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532969.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14516 pDONR223 100% 31.3% 2.5% None (many diffs) n/a
2 ccsbBroad304_14516 pLX_304 0% 31.3% 2.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488229 GTCTAAAATAGCCAGCCTTCATGC pLX_317 37.9% 26.9% 28.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV