Transcript: Mouse XM_006533018.4

PREDICTED: Mus musculus K(lysine) acetyltransferase 7 (Kat7), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Kat7 (217127)
Length:
3378
CDS:
484..1851

Additional Resources:

NCBI RefSeq record:
XM_006533018.4
NBCI Gene record:
Kat7 (217127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533018.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366274 TTATGACAGAAGCGGACAATA pLKO_005 1349 CDS 100% 13.200 18.480 N Kat7 n/a
2 TRCN0000374903 ACCATAAGACGCTATACTATG pLKO_005 1304 CDS 100% 10.800 15.120 N Kat7 n/a
3 TRCN0000374846 TCGAGTACAGATCCCTCATAG pLKO_005 2078 3UTR 100% 10.800 15.120 N Kat7 n/a
4 TRCN0000366275 CCTCGAACTCCAACCGGAAAT pLKO_005 391 5UTR 100% 10.800 8.640 N Kat7 n/a
5 TRCN0000039239 CCCATGCTTTCCTTTGTATTT pLKO.1 2504 3UTR 100% 13.200 9.240 N Kat7 n/a
6 TRCN0000379114 GAGAGACAGCTGCGGTATAAG pLKO_005 778 CDS 100% 13.200 9.240 N Kat7 n/a
7 TRCN0000039240 GCCCTTCAGATGCTCAAGTAT pLKO.1 1696 CDS 100% 5.625 3.938 N Kat7 n/a
8 TRCN0000039243 CCTGACAAGTGAATATGACTT pLKO.1 915 CDS 100% 4.950 3.465 N Kat7 n/a
9 TRCN0000039241 CGAAAGCTACAATTTCAACAT pLKO.1 543 CDS 100% 4.950 3.465 N Kat7 n/a
10 TRCN0000039242 GACCTGATAGATGAGTGGATA pLKO.1 1750 CDS 100% 4.950 3.465 N Kat7 n/a
11 TRCN0000021630 CGGGATAAGCAGATAGAAGAA pLKO.1 694 CDS 100% 4.950 2.970 N KAT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533018.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07760 pDONR223 100% 67.8% 74.4% None (many diffs) n/a
2 ccsbBroad304_07760 pLX_304 0% 67.8% 74.4% V5 (many diffs) n/a
3 TRCN0000475389 TATGTTGACTTCCAATGAAAGGCT pLX_317 19.8% 67.8% 74.4% V5 (many diffs) n/a
Download CSV