Transcript: Mouse XM_006533108.3

PREDICTED: Mus musculus rhomboid 5 homolog 2 (Rhbdf2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rhbdf2 (217344)
Length:
3548
CDS:
365..2428

Additional Resources:

NCBI RefSeq record:
XM_006533108.3
NBCI Gene record:
Rhbdf2 (217344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533108.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418934 GTCAAACGCAGCTTCGCTTAC pLKO_005 1076 CDS 100% 6.000 8.400 N Rhbdf2 n/a
2 TRCN0000432691 CCAGCTCGATTGACCTCATTC pLKO_005 1662 CDS 100% 10.800 8.640 N Rhbdf2 n/a
3 TRCN0000423160 ACATCTGGCCTGATGACATTA pLKO_005 1971 CDS 100% 13.200 9.240 N Rhbdf2 n/a
4 TRCN0000032698 CCGTGCAAGATGCCCAAGATT pLKO.1 812 CDS 100% 5.625 3.938 N Rhbdf2 n/a
5 TRCN0000032696 GCACATAGACTGTAAGATCAA pLKO.1 2044 CDS 100% 4.950 3.465 N Rhbdf2 n/a
6 TRCN0000032697 GCTGACGTTCGTTCACATCAT pLKO.1 1501 CDS 100% 4.950 3.465 N Rhbdf2 n/a
7 TRCN0000032695 GCCTCCAAAGTAAAGCACTTT pLKO.1 1340 CDS 100% 0.495 0.347 N Rhbdf2 n/a
8 TRCN0000032694 CCTCCTTTCTCAGGTCTGAAT pLKO.1 2830 3UTR 100% 4.950 2.970 N Rhbdf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533108.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12583 pDONR223 100% 50.8% 45.2% None (many diffs) n/a
2 ccsbBroad304_12583 pLX_304 0% 50.8% 45.2% V5 (many diffs) n/a
3 TRCN0000468604 ATCATTTCAATCTCAATGCATTGT pLX_317 20.6% 50.8% 45.2% V5 (many diffs) n/a
Download CSV