Transcript: Mouse XM_006533488.3

PREDICTED: Mus musculus zinc finger protein 385C (Zfp385c), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp385c (278304)
Length:
2975
CDS:
154..1686

Additional Resources:

NCBI RefSeq record:
XM_006533488.3
NBCI Gene record:
Zfp385c (278304)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533488.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434706 GAACCTATCAGGCATATTTAC pLKO_005 2080 3UTR 100% 13.200 18.480 N Zfp385c n/a
2 TRCN0000435512 TCTAGAGCGGTCTGGACAATC pLKO_005 2025 3UTR 100% 10.800 15.120 N Zfp385c n/a
3 TRCN0000173904 GCTGTCATCAGCCACACATTT pLKO.1 571 CDS 100% 13.200 9.240 N Zfp385c n/a
4 TRCN0000433933 ACCAAGAGAGTGATAGGAAAT pLKO_005 1234 CDS 100% 10.800 7.560 N Zfp385c n/a
5 TRCN0000193412 CCTGCATCTATGATTTAACAA pLKO.1 1878 3UTR 100% 5.625 3.938 N Zfp385c n/a
6 TRCN0000194103 GCTGTTCATCTCCTGTAACAT pLKO.1 618 CDS 100% 5.625 3.938 N Zfp385c n/a
7 TRCN0000174769 GCTCTTCTTATCTTAGCCTTT pLKO.1 2623 3UTR 100% 4.050 2.835 N Zfp385c n/a
8 TRCN0000174040 CCCTACCTGTAAAGTGACAGT pLKO.1 1086 CDS 100% 2.640 1.848 N Zfp385c n/a
9 TRCN0000194587 CCATGTCAATTCAGAGACCCA pLKO.1 1308 CDS 100% 0.660 0.462 N Zfp385c n/a
10 TRCN0000180871 GAAGCAACTCACCAAGACGTT pLKO.1 1467 CDS 100% 2.640 1.848 N ZNF385C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533488.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13387 pDONR223 100% 29.4% 29% None (many diffs) n/a
2 ccsbBroad304_13387 pLX_304 0% 29.4% 29% V5 (many diffs) n/a
3 TRCN0000481069 TGTAAGCGTCCTCGCATTTACTGC pLX_317 76% 29.4% 29% V5 (many diffs) n/a
Download CSV