Transcript: Mouse XM_006534000.3

PREDICTED: Mus musculus methyltransferase like 16 (Mettl16), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl16 (67493)
Length:
9735
CDS:
150..1670

Additional Resources:

NCBI RefSeq record:
XM_006534000.3
NBCI Gene record:
Mettl16 (67493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534000.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217382 GATCTGAAGGTGCAACATAAG pLKO.1 1062 CDS 100% 10.800 15.120 N Mettl16 n/a
2 TRCN0000175679 GCCAAGGAAACCCATTACTTT pLKO.1 929 CDS 100% 5.625 7.875 N Mettl16 n/a
3 TRCN0000175949 GCACTTACGTACGTAACCAAA pLKO.1 1627 CDS 100% 4.950 6.930 N Mettl16 n/a
4 TRCN0000175880 GCCTATTTCAGAACCAGAGTT pLKO.1 2432 3UTR 100% 4.950 3.465 N Mettl16 n/a
5 TRCN0000193099 CCATGACAGTTTACAGCTCAA pLKO.1 704 CDS 100% 4.050 2.835 N Mettl16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534000.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08916 pDONR223 100% 77.7% 79.3% None (many diffs) n/a
2 ccsbBroadEn_14256 pDONR223 100% 28.9% None (many diffs) n/a
3 ccsbBroad304_14256 pLX_304 0% 28.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000480867 ATGGGCCCGATCGCCAATGAGTTT pLX_317 63.9% 28.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV