Transcript: Mouse XM_006534038.2

PREDICTED: Mus musculus dephospho-CoA kinase domain containing (Dcakd), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dcakd (68087)
Length:
1878
CDS:
349..1044

Additional Resources:

NCBI RefSeq record:
XM_006534038.2
NBCI Gene record:
Dcakd (68087)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024818 GTAATCGACGTGGACGTCATT pLKO.1 430 CDS 100% 4.950 6.930 N Dcakd n/a
2 TRCN0000024814 CCGATACGTGATTCTGGACAT pLKO.1 669 CDS 100% 4.050 5.670 N Dcakd n/a
3 TRCN0000274793 CCGATACGTGATTCTGGACAT pLKO_005 669 CDS 100% 4.050 5.670 N Dcakd n/a
4 TRCN0000024816 CGGCGTATAGTAGAGGCCTTT pLKO.1 487 CDS 100% 4.050 5.670 N Dcakd n/a
5 TRCN0000374394 CCAAGAAGCTGCTCAAGTATA pLKO_005 707 CDS 100% 13.200 9.240 N Dcakd n/a
6 TRCN0000274794 AGTGTACTGTGACCGTGATAC pLKO_005 744 CDS 100% 10.800 7.560 N Dcakd n/a
7 TRCN0000274732 GTCTAGTGGACCACAGCAAAT pLKO_005 1413 3UTR 100% 10.800 7.560 N Dcakd n/a
8 TRCN0000024817 CCAATCACGTTCTGGACAACT pLKO.1 863 CDS 100% 4.950 3.465 N Dcakd n/a
9 TRCN0000274734 CCAATCACGTTCTGGACAACT pLKO_005 863 CDS 100% 4.950 3.465 N Dcakd n/a
10 TRCN0000024815 GCGGCTGATGAAGCGGAACAA pLKO.1 774 CDS 100% 1.650 1.155 N Dcakd n/a
11 TRCN0000323429 GCGGCTGATGAAGCGGAACAA pLKO_005 774 CDS 100% 1.650 1.155 N Dcakd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04143 pDONR223 100% 86% 90.9% None (many diffs) n/a
2 ccsbBroad304_04143 pLX_304 0% 86% 90.9% V5 (many diffs) n/a
3 TRCN0000468920 ACGAGTGCAACTTTACATCTACAT pLX_317 50.2% 86% 90.9% V5 (many diffs) n/a
4 ccsbBroadEn_15156 pDONR223 0% 86% 90.9% None (many diffs) n/a
5 ccsbBroad304_15156 pLX_304 0% 86% 90.9% V5 (many diffs) n/a
6 TRCN0000465914 ACAGGCTATCTCGGTAAAGTGATA pLX_317 35.9% 86% 90.9% V5 (many diffs) n/a
Download CSV