Transcript: Mouse XM_006534185.3

PREDICTED: Mus musculus TATA-box binding protein associated factor 15 (Taf15), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Taf15 (70439)
Length:
1901
CDS:
191..1615

Additional Resources:

NCBI RefSeq record:
XM_006534185.3
NBCI Gene record:
Taf15 (70439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102481 GCTCGAAGAAACTCCTGTAAT pLKO.1 1046 CDS 100% 13.200 18.480 N Taf15 n/a
2 TRCN0000287736 GCTCGAAGAAACTCCTGTAAT pLKO_005 1046 CDS 100% 13.200 18.480 N Taf15 n/a
3 TRCN0000295194 TGGGTAGTGAAATTGACATTT pLKO_005 1699 3UTR 100% 13.200 18.480 N Taf15 n/a
4 TRCN0000020141 CGTCGTGATGTGAGTAGGTAT pLKO.1 425 CDS 100% 4.950 6.930 N TAF15 n/a
5 TRCN0000295146 CCACTAGAAGGCCTGAATTTA pLKO_005 888 CDS 100% 15.000 12.000 N Taf15 n/a
6 TRCN0000102480 CTCCTTTGTCTCTGACATGAT pLKO.1 1631 3UTR 100% 4.950 3.465 N Taf15 n/a
7 TRCN0000102484 CAGAGTCTGATAATTCAGATA pLKO.1 612 CDS 100% 0.495 0.347 N Taf15 n/a
8 TRCN0000102482 GCAGCCATTGATTGGTTTGAT pLKO.1 827 CDS 100% 5.625 3.375 N Taf15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07204 pDONR223 100% 74.3% 63% None (many diffs) n/a
2 ccsbBroad304_07204 pLX_304 0% 74.3% 63% V5 (many diffs) n/a
3 TRCN0000477554 GACGTCATATTTTGGCCCCCAGCC pLX_317 1.1% 74.3% 63% V5 (many diffs) n/a
Download CSV