Transcript: Mouse XM_006534589.3

PREDICTED: Mus musculus small G protein signaling modulator 2 (Sgsm2), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgsm2 (97761)
Length:
3353
CDS:
104..2149

Additional Resources:

NCBI RefSeq record:
XM_006534589.3
NBCI Gene record:
Sgsm2 (97761)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093180 GCCTTAAATCTGCACCGCATA pLKO.1 1499 CDS 100% 4.050 3.240 N Sgsm2 n/a
2 TRCN0000093179 CCTCTCAAACAACTTAGAATA pLKO.1 2451 3UTR 100% 13.200 9.240 N Sgsm2 n/a
3 TRCN0000093182 GCAGCCTATACTATAGAATTA pLKO.1 1466 CDS 100% 13.200 9.240 N Sgsm2 n/a
4 TRCN0000093181 CCGTGACAACAACATGGACTT pLKO.1 2014 CDS 100% 4.050 2.835 N Sgsm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14032 pDONR223 100% 57.4% 6.3% None (many diffs) n/a
2 ccsbBroad304_14032 pLX_304 0% 57.4% 6.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477986 TCTGCATGAAGTGAAGCCCGGGGC pLX_317 9.1% 57.4% 6.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV