Transcript: Mouse XM_006535140.3

PREDICTED: Mus musculus USO1 vesicle docking factor (Uso1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uso1 (56041)
Length:
3953
CDS:
190..3090

Additional Resources:

NCBI RefSeq record:
XM_006535140.3
NBCI Gene record:
Uso1 (56041)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535140.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381349 TTGAGTTCTCGGCTGATTAAT pLKO_005 3472 3UTR 100% 15.000 21.000 N Uso1 n/a
2 TRCN0000305493 ATGATAGAGATTACGTCATTA pLKO_005 3106 3UTR 100% 13.200 18.480 N Uso1 n/a
3 TRCN0000111659 CGTGACTCACTATAAGAATAT pLKO.1 2163 CDS 100% 13.200 18.480 N Uso1 n/a
4 TRCN0000309865 CGTGACTCACTATAAGAATAT pLKO_005 2163 CDS 100% 13.200 18.480 N Uso1 n/a
5 TRCN0000111656 CCGAGCAAGTTGCAGAGTTAA pLKO.1 2561 CDS 100% 13.200 10.560 N Uso1 n/a
6 TRCN0000111658 CGAGCAAGTTGCAGAGTTAAA pLKO.1 2562 CDS 100% 13.200 10.560 N Uso1 n/a
7 TRCN0000309866 CGAGCAAGTTGCAGAGTTAAA pLKO_005 2562 CDS 100% 13.200 10.560 N Uso1 n/a
8 TRCN0000111657 CGCTTAGAAGTGGGAATCCAA pLKO.1 349 CDS 100% 3.000 2.400 N Uso1 n/a
9 TRCN0000305438 ATCCTGACAGAGACCATAAAT pLKO_005 1174 CDS 100% 15.000 10.500 N Uso1 n/a
10 TRCN0000311328 TGTTATTACCAAGGCTATTTA pLKO_005 2076 CDS 100% 15.000 10.500 N Uso1 n/a
11 TRCN0000381481 CTTACTACTGCAGGCATTAAC pLKO_005 750 CDS 100% 13.200 9.240 N Uso1 n/a
12 TRCN0000065072 GCACAGAAAGTGACCAATCTA pLKO.1 1009 CDS 100% 5.625 3.938 N USO1 n/a
13 TRCN0000111655 GCAGTTCATATAGCTGGGATT pLKO.1 3748 3UTR 100% 4.050 2.835 N Uso1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535140.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11284 pDONR223 100% 85.5% 91.6% None (many diffs) n/a
2 ccsbBroad304_11284 pLX_304 0% 85.5% 91.6% V5 (many diffs) n/a
3 TRCN0000478906 GCCTACTCATTTACTGCACACCAA pLX_317 14.3% 85.5% 91.6% V5 (many diffs) n/a
Download CSV