Transcript: Mouse XM_006535263.2

PREDICTED: Mus musculus CDP-diacylglycerol synthase 1 (Cds1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cds1 (74596)
Length:
3752
CDS:
243..1457

Additional Resources:

NCBI RefSeq record:
XM_006535263.2
NBCI Gene record:
Cds1 (74596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075698 CCGTGAAAGATCCTGTACTTT pLKO.1 1653 3UTR 100% 5.625 7.875 N Cds1 n/a
2 TRCN0000075699 GCAGATTACTTCGCCACGTTT pLKO.1 729 CDS 100% 4.950 6.930 N Cds1 n/a
3 TRCN0000075701 GCAAACACGATTCCTGGACAT pLKO.1 1230 CDS 100% 4.050 5.670 N Cds1 n/a
4 TRCN0000075700 CGGACTATCTTCAAGATGGAA pLKO.1 473 CDS 100% 3.000 4.200 N Cds1 n/a
5 TRCN0000075702 CTCTTCTTCCTGATTATCTAT pLKO.1 537 CDS 100% 5.625 3.938 N Cds1 n/a
6 TRCN0000035842 CCAGCGACAAAGAAACAGATA pLKO.1 349 CDS 100% 4.950 3.465 N CDS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00286 pDONR223 100% 75.1% 83.5% None (many diffs) n/a
2 ccsbBroad304_00286 pLX_304 0% 75.1% 83.5% V5 (many diffs) n/a
3 TRCN0000476870 CCTTATTCGGCCTCCTTTGTAGAA pLX_317 7.2% 75.1% 83.5% V5 (many diffs) n/a
Download CSV