Transcript: Mouse XM_006535411.3

PREDICTED: Mus musculus protein kinase C, iota (Prkci), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkci (18759)
Length:
3345
CDS:
244..1941

Additional Resources:

NCBI RefSeq record:
XM_006535411.3
NBCI Gene record:
Prkci (18759)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219728 CTTCATGAGCGAGGGATAATT pLKO.1 1255 CDS 100% 15.000 21.000 N PRKCI n/a
2 TRCN0000022755 CGAGGGATAATTTATAGAGAT pLKO.1 1264 CDS 100% 4.950 6.930 N Prkci n/a
3 TRCN0000278130 CGAGGGATAATTTATAGAGAT pLKO_005 1264 CDS 100% 4.950 6.930 N Prkci n/a
4 TRCN0000022758 CCAGACAGAAAGCAGGTTGTT pLKO.1 1116 CDS 100% 4.950 3.465 N Prkci n/a
5 TRCN0000278128 CCAGACAGAAAGCAGGTTGTT pLKO_005 1116 CDS 100% 4.950 3.465 N Prkci n/a
6 TRCN0000022756 CCGTTCACCATGAAATGGATA pLKO.1 436 CDS 100% 4.950 3.465 N Prkci n/a
7 TRCN0000278129 CCGTTCACCATGAAATGGATA pLKO_005 436 CDS 100% 4.950 3.465 N Prkci n/a
8 TRCN0000022754 GCTCTGACAATCCTGACCAAA pLKO.1 1523 CDS 100% 4.950 3.465 N Prkci n/a
9 TRCN0000297398 GCTCTGACAATCCTGACCAAA pLKO_005 1523 CDS 100% 4.950 3.465 N Prkci n/a
10 TRCN0000022757 GCAATGAAAGTTGTGAAGAAA pLKO.1 991 CDS 100% 5.625 3.375 N Prkci n/a
11 TRCN0000297180 GCAATGAAAGTTGTGAAGAAA pLKO_005 991 CDS 100% 5.625 3.375 N Prkci n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489076 TCTCCCTTAAGCAACTGGCTCAAG pLX_317 21.1% 84.5% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492100 CGAACTACGAGCACTCCTTCAATT pLX_317 23.8% 84.5% 91.6% V5 (many diffs) n/a
3 TRCN0000488985 GTATGCCGGGCTCAGTCACGTCTA pLX_317 20.9% 84.5% 91.6% V5 (many diffs) n/a
4 TRCN0000491894 ATATTCCACAGTCCAAGCCCTCGA pLX_317 23.9% 84.5% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14793 pDONR223 0% 84.3% 91.2% None (many diffs) n/a
6 ccsbBroad304_14793 pLX_304 0% 84.3% 91.2% V5 (many diffs) n/a
7 TRCN0000471245 CAGAAAGATACCCGGATTTTGCCA pLX_317 24.1% 84.2% 91.1% V5 (many diffs) n/a
8 TRCN0000488430 TTCCGAGGTATATATCCTAGTCCC pLX_317 21.4% 84.3% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV