Transcript: Mouse XM_006535556.1

PREDICTED: Mus musculus armadillo repeat containing 1 (Armc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Armc1 (74252)
Length:
2938
CDS:
220..1050

Additional Resources:

NCBI RefSeq record:
XM_006535556.1
NBCI Gene record:
Armc1 (74252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147693 GCTCAAGTTGTGCATGAATTA pLKO.1 1425 3UTR 100% 13.200 18.480 N ARMC1 n/a
2 TRCN0000249034 GTTAACCAGCTACGGGATTTA pLKO_005 271 CDS 100% 13.200 18.480 N Armc1 n/a
3 TRCN0000217274 CATAGATGGTCTCGATGATAC pLKO.1 663 CDS 100% 10.800 15.120 N Armc1 n/a
4 TRCN0000249032 CATAGATGGTCTCGATGATAC pLKO_005 663 CDS 100% 10.800 15.120 N Armc1 n/a
5 TRCN0000249031 TGGCTGAATGCCGTGCGAATA pLKO_005 416 CDS 100% 10.800 15.120 N Armc1 n/a
6 TRCN0000190724 GTCAGCAATAGCATCAACCAA pLKO.1 810 CDS 100% 3.000 4.200 N Armc1 n/a
7 TRCN0000249033 CATCCTTCAATCCTCCAATTT pLKO_005 543 CDS 100% 13.200 10.560 N Armc1 n/a
8 TRCN0000191516 GAAATCTATGACATCCTTCAA pLKO.1 532 CDS 100% 4.950 3.465 N Armc1 n/a
9 TRCN0000190796 GCACATCTCTAAGCTGTGTAA pLKO.1 2623 3UTR 100% 4.950 3.465 N Armc1 n/a
10 TRCN0000128675 CAATAGCATCAACCAAGGTTA pLKO.1 815 CDS 100% 4.950 3.465 N ARMC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03537 pDONR223 100% 88.4% 96% None (many diffs) n/a
2 ccsbBroad304_03537 pLX_304 0% 88.4% 96% V5 (many diffs) n/a
3 TRCN0000472769 GTTGGCAATCCCTGTACGTCTAAC pLX_317 20.4% 88.4% 96% V5 (many diffs) n/a
Download CSV